سامانه پژوهشی – کلونینگ، بیان، تخلیص و بررسی فعالیت آنزیم سراپپتیداز حاصل از سراشیا مارسسنس۹۲- قسمت …

۳-۵-۲ طراحی پرایمر و انجام PCR
پرایمر ها به صورت زیر طراحی شدند:
oC7 /61Forward primer A: Tm=
(۵’-GCCGCCACAACTGGTTACG-3′)
Reverse primer B :
oC3/60(5′- AAACTCGAGTTACATGATAAAGTCCGTGGCG-3′) Tm=
۳-۵-۲-۱مراحل PCR
واکنش PCR با استفاده از استوکی با غلظت ۲۰پیکومول از هر پرایمر و حامل pTZ57R/T در بر گیرنده ژن سراپپتیداز به عنوان الگو انجام شد. مخلوط واکنش شامل مواد زیر در حجم ۲۵ میکرولیتر بود:
۱۰ mM dNTP; 2 μl
۱۰X PCR buffer; 2.5 μl
۵۰ mM MgCl2; 2 μl
۲۰ pmol Forward primer; 1 μl
۲۰ pmol Reverse primer; 1 μl
۵ unit/μl of Taq polymerase; 0.5 μl
Recombinant plasmid DNA; 1.5 μl
DW 14.5 μl
واکنش PCR مطابق با برنامه ذیل انجام گرفت:
Primary denaturation temperature= 95°C 5min
Denaturation temperature = 95°C30 sec
Annealing temperature =55˚C 1min
Extension temperature = 72°C90 sec
Final extension temperature =72°C 20 min
در مرحله بعد محصول PCR بر روی ژل آگارز %۱ الکتروفورز برده شد و پس از رنگ آمیزی با اتیدیوم بروماید تکثیر قطعه ای در ۱۵۰۰ جفت باز بررسی شد. سپس قطعه های مورد نظر توسط کیت PCR productClean up شد و برای کلون کردن در حامل بیانی(+) pET28-a مورد استفاده قرار گرفت.
۳-۵-۳ کلون سازی ژن سراپپتیداز در وکتور T/A
در این مرحله قطعه bp 1500 در وکتور PTZ57R/T از کیت T/A کلونینگ (Fermentas) کلون گردید. این واکنش شامل ۲ میکرولیتر وکتور PTZ57R/T، ۳ میکرولیتر بافر (×۵)، ۳ میکرولیتر آب مقطر استریل، ۱ میکرولیتر DNA لیگاز T4 و ۶ میکرولیتر محصول PCR بود. در مرحله بعد ۱۵ میکرولیتر از مخلوط الحاق به ۱۵۰ میکرولیتر سلول های باکتری E.coli DH5α مستعد اضافه شد و فرآیند انتقال ژن به باکتری انجام شد که در قسمت های بعدی به شرح مفصل آن پرداخته شده است. سپس در سطح پلیت محیط LB آگار واجد ۵۰ میکروگرم در هر میلی لیتر آمپی سیلین، ۱۰۰ میلی مولار IPTG، ۲۰ میلی گرم در هر میلی لیتر X-Gal پخش و در دمای ۳۷ درجه سانتی گراد گرما گذاری گردید.
در مرحله بعد کلنی های سفید (نشان دهنده باکتری های ترانسفورم شده ) پس از گرما گذاری برای بررسی حضور ژن مورد نظر در وکتور T/A با استفاده از تکنیک PCR مورد ارزیابی قرار گرفتند. واکنش PCR شامل ۱۲٫۵ میکرولیتر master mix، ۱ میکرولیتر از هر یک از پرایمر ها، ۱ میکرولیتر از نمونه و ۹٫۵ میکرولیتر آب مقطر استریل بود. کلنی های دارای واکنش مثبت PCR، به مدت یک شب در ۴ میلی لیتر محیط LB مایع حاوی ۵۰ میکروگرم در هر میلی لیتر آمپی سیلین کشت داده شدند. پلاسمید نوترکیب با استفاده از کیت Bioneer و دستورالعمل شرکت سازنده استخراج و خالص سازی گردید و باند مورد نظر روی ژل مشاهده شد و برای تعیین توالی به شرکت پیشگام ارسال گردید. سپس از طریق BLAST ژن مورد نظر با توالی های نوکلئوتیدی مربوط به ژن سراپپتیداز در سایت NCBI (www.ncbi.nlm.nih.gov) مقایسه شد.
۳-۵-۴ رسم درخت فیلوژنتیک
محصول PCR بعد از تعیین توالی،۱۵۰۰جفت باز را نشان داد که با مقایسه با سایر ژنهای ۱۶SrDNA گونه های سراشیا مارسسنس موجود در مرکز ملی بیوتکنولوژیNCBIwww.ncbi.nlm.nih.gov)) درخت فیلوژنتیکی برای آن رسم گردید.
۳-۵-۵ تعیین توالی ژن کد کننده سراپپتیداز
مطالعات فیلوژنتیکی با استفاده از آنالیز ۱۶S rDNA نیز همولوژی نزدیک گونه(Serratia marcescens ZF03)را به سوشهایی نظیرSerratia marcescensZhenJiangبا ۹۹% همانندیو۹۸% شباهت Serratia marcescensHR-3 نشان داد. یک جفت پرایمر Forward ویک جفت پرایمر Reverse طراحی شدند.این پرایمرها بر اساس توالی ژنهایSerratia marcescens ZhenJiang و(Serratia marcescens HR-3) استخراج شده از GenBank و مقایسه آنها با هم از طریق بررسی همولوژی بین آنها طراحی وسپس از طریق نرم افزار Gene runner امکان ایجاد لوپ، دیمر و Tm آنها مطالعه گردید.
Forward primer A:
oC 60(5′- AAACATATGCAATCTATCAAAAAGGC -3′) Tm=
Reverse primer B :
oC 71(5′- AAACTCGAGTTACATGATAAAGTCCGTGGCG-3′) Tm=
:PCR
واکنش PCR مطابق با برنامه ذیل انجام گرفت:
Primary denaturation temperature= 95°C 5min
Denaturation temperature = 95°C 30 sec
Annealing temperature =57˚C 1min
Extension temperature = 72°C 90 sec

دانلود متن کامل پایان نامه در سایت jemo.ir موجود است